Introduction
Command line basics, sequence context, BLAST, and how phage genomes are read.
Introduction
Slides: The flow of genetic information
Slide material from the original manual is not embedded on this public page.
Activity 1: From DNA to Protein
Rationale
We will start by manually translating a DNA sequence into a protein sequence.
Activity 1
1 CTATTATACCAATCGGCTTCATGTATCCGCACGCGGGCGAAATTAGCCCG 50 51 CGCGAAACCACCTATTAACCTGACGAGGAGGCCCACACGCGAGGAAGATG 100 101 GCGGATAGCTGCATTGAAAACACCATTAGCACCTGGGCGCGCAACATTAA 150 151 CGGCTGATAGACTGTTGCACGTTGGGGGAGAACATCCAGATAGCGCTAGC 200 201 TATGATTTCCTCTGAACTGTTGATAGAGTGGGCTTCCCACGAGCGCGAAT 250 251 AGTAAGCGAATAGAACAAAGACGCCTGCTACAACAGGAGTATCAACCCGT 300 - Find all the possible start codons.
- Using the DNA codon translation table, translate the DNA sequence into amino acid sequences from the start codon until you hit a stop codon.
- Answer the following for each amino acid sequence:
- What is the amino acid sequence?
- How long is each amino acid sequence?
- How long is the nucleotide sequence?
- Write your own DNA sequence coding for a small mock protein with 10 amino acids of your choice.
Activity 2: Exploring phage genomes in NCBI
Rationale
NCBI is the National Center for Biotechnology Information, and it’s one of many online resources where biological data is stored. Their website, https://www.ncbi.nlm.nih.gov/, hosts many different databases. We will explore how to use some of them to learn more about the biological sequences we find.
Activity 2.1
- Follow along:
- Go to the the NCBI website and look for the genome with the following accession
NC_002371.2- (Here’s the direct link but try to find it yourself first!)
- Try to find the following information:
- Where can you find the accession?
- How big is the genome?
- What other properties of the genome can you find in the
LOCUSline? - What type of phage is it? (Siphoviridae, Podoviridae, Myoviridae, other?)
- Can you find the bacterial host?
- Go back to the top and find the
FASTAview. Click it. What do you see? Looks familiar? - Go into the
Graphicsview. Zoom in, move around, hover over the boxes. What do you see?- What does the boxes represent?
- What are the arrows in the box?
- Look for the head protein and zoom until you can see the nucleotide sequence. Can you find the
STARTcodon?
- Go back to the
GenBankview. (Make sureWhole sequenceis selected in the top right corner!) Scroll down until you find theFEATURESsection.- Can you find the sequence for the head protein?
- Can you find a protein that says hypothetical protein? What does this mean?
Activity 2.2
- Now, you’ll each have an accession code for a phage genome. Follow the instructions bellow and take notes of what you find, so that you tell the rest of the class what you learned about your phage.
- Select an accession code from the bag:
XXXXXXXXXXXXXX
- Go to NCBI and find the genome record.
- Find the following information about your phage:
- How big is the genome?
- Is the genome DNA or RNA, linear or circular?
- What type of phage is it? (Siphoviridae, Podoviridae, Myoviridae, other?)
- Can you find the bacterial host?
- Can you find the coat protein (or capsid protein)?
Activity 3: Search DNA sequences with BLAST
Rationale
Here, we’ll start with one of the most popular ways to search for sequences, a program called BLAST💥. It’s so popular that it’s become a verb among biologists: “BLASTing”. You can think about it as the Google for biological sequences. We’ll learn how to BLAST a phage genome, which will help us find other related phages.
Activity 3
- Open the BLAST website
- Click on Nucleotide
BLAST- When would you use Protein
BLAST?
- When would you use Protein
- Explore the
BLASTwindow.- What is Query?
- What databases are available?
- In a new tab, open NCBI and find the genome record for the phage you selected in the Activity 2.2.
- Go to the
FASTAview, and copy the DNA sequence of your phage. - Return to the tab with
BLASTand copy the sequence into the Query box. - Click on the button that says BLAST and wait for the results.
- Take notes about some of the top results of your search.
- Are there other phages that look a lot like your phage?
- How similar or how different are they?
- How do the Query Cover percentages look like?
- How do the Percent Identity values look like?